Product Details

SNP ID: rs137124
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.22:42619710 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CCAGTGTGCGATGTGGGGAGGTGAC[C/T]GGGTGAGCGTGAACAGGGCGTGGGG
Phenotype: MIM: 613213 MIM: 611520
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CYB5R3 PubMed Links

Gene Details

Gene: CYB5R3
Gene Name: cytochrome b5 reductase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000398.6	1193	UTR 3			NP_000389.1
NM_001129819.2	1193	UTR 3			NP_001123291.1
NM_001171660.1	1193	UTR 3			NP_001165131.1
NM_001171661.1	1193	UTR 3			NP_001165132.1
NM_007326.4	1193	UTR 3			NP_015565.1

Gene: POLDIP3
Gene Name: DNA polymerase delta interacting protein 3

There are no transcripts associated with this gene.

Gene: RNU12
Gene Name: RNA, U12 small nuclear

There are no transcripts associated with this gene.

View Full Product Details