Product Details

SNP ID: rs222765
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:3676564 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGGAGGAAGCCTCTTGGTCTCTAGG[C/T]AGCATGCGTGTAAGTCTGACCTAGA
Phenotype: MIM: 602836 MIM: 616484
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: EMC6 PubMed Links

Gene Details

Gene: EMC6
Gene Name: ER membrane protein complex subunit 6

There are no transcripts associated with this gene.

Gene: P2RX5
Gene Name: purinergic receptor P2X 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204519.1		Intron			NP_001191448.1
NM_001204520.1		Intron			NP_001191449.1
NM_002561.3		Intron			NP_002552.2
NM_175080.2		Intron			NP_778255.1

Gene: P2RX5-TAX1BP3
Gene Name: P2RX5-TAX1BP3 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: TAX1BP3
Gene Name: Tax1 binding protein 3

There are no transcripts associated with this gene.

View Full Product Details