Product Details

SNP ID

rs1436524

Assay Type

Validated

NCBI dbSNP Submissions

NA

Location

Chr.4:86018624 on Build GRCh38

Set Membership

HapMap Validated

Context Sequence [VIC/FAM]

GATGAACCAAAGGCATTGTGCGATA[C/T]AATTAAACCAGAGCACCCTGGAAAC

Phenotype

MIM: 602897

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

MAPK10 PubMed Links

Additional Information

For this assay, SNP(s) [rs17011322] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

MAPK10

Gene Name

mitogen-activated protein kinase 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318067.1		Intron			NP_001304996.1
NM_001318068.1		Intron			NP_001304997.1
NM_001318069.1		Intron			NP_001304998.1
NM_002753.4		Intron			NP_002744.1
NM_138980.3		Intron			NP_620446.1
NM_138982.3		Intron			NP_620448.1
XM_005263129.2		Intron			XP_005263186.1
XM_005263130.2		Intron			XP_005263187.1
XM_005263131.2		Intron			XP_005263188.1
XM_005263135.3		Intron			XP_005263192.1
XM_006714268.2		Intron			XP_006714331.1
XM_006714269.2		Intron			XP_006714332.1
XM_011532117.2		Intron			XP_011530419.1
XM_011532118.2		Intron			XP_011530420.1
XM_011532120.2		Intron			XP_011530422.1
XM_011532121.2		Intron			XP_011530423.1
XM_017008419.1		Intron			XP_016863908.1
XM_017008420.1		Intron			XP_016863909.1
XM_017008421.1		Intron			XP_016863910.1
XM_017008422.1		Intron			XP_016863911.1
XM_017008423.1		Intron			XP_016863912.1
XM_017008424.1		Intron			XP_016863913.1
XM_017008425.1		Intron			XP_016863914.1
XM_017008426.1		Intron			XP_016863915.1
XM_017008427.1		Intron			XP_016863916.1
XM_017008428.1		Intron			XP_016863917.1
XM_017008429.1		Intron			XP_016863918.1
XM_017008430.1		Intron			XP_016863919.1
XM_017008431.1		Intron			XP_016863920.1
XM_017008432.1		Intron			XP_016863921.1
XM_017008433.1		Intron			XP_016863922.1
XM_017008434.1		Intron			XP_016863923.1
XM_017008435.1		Intron			XP_016863924.1
XM_017008436.1		Intron			XP_016863925.1
XM_017008437.1		Intron			XP_016863926.1
XM_017008438.1		Intron			XP_016863927.1
XM_017008439.1		Intron			XP_016863928.1
XM_017008440.1		Intron			XP_016863929.1
XM_017008441.1		Intron			XP_016863930.1
XM_017008442.1		Intron			XP_016863931.1
XM_017008443.1		Intron			XP_016863932.1
XM_017008444.1		Intron			XP_016863933.1
XM_017008445.1		Intron			XP_016863934.1
XM_017008446.1		Intron			XP_016863935.1
XM_017008447.1		Intron			XP_016863936.1
XM_017008448.1		Intron			XP_016863937.1
XM_017008449.1		Intron			XP_016863938.1
XM_017008450.1		Intron			XP_016863939.1
XM_017008451.1		Intron			XP_016863940.1
XM_017008452.1		Intron			XP_016863941.1
XM_017008453.1		Intron			XP_016863942.1
XM_017008454.1		Intron			XP_016863943.1

View Full Product Details