Product Details

SNP ID: rs2164885
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:52697253 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTATAAGTCTTATTCATTTTCAAAA[C/T]GGATTAGACTATCCAAGTTTCCCCA
Phenotype: MIM: 608011 MIM: 610358
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GLT8D1 PubMed Links

Gene Details

Gene: GLT8D1
Gene Name: glycosyltransferase 8 domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001010983.2		Intron			NP_001010983.1
NM_001278280.1		Intron			NP_001265209.1
NM_001278281.1		Intron			NP_001265210.1
NM_018446.3		Intron			NP_060916.1
NM_152932.2		Intron			NP_690909.1
XM_017006857.1		Intron			XP_016862346.1
XM_017006858.1		Intron			XP_016862347.1
XM_017006859.1		Intron			XP_016862348.1

Gene: GNL3
Gene Name: G protein nucleolar 3

There are no transcripts associated with this gene.

Gene: SNORD136
Gene Name: small nucleolar RNA, C/D box 136

There are no transcripts associated with this gene.

Gene: SNORD19
Gene Name: small nucleolar RNA, C/D box 19

There are no transcripts associated with this gene.

Gene: SNORD19B
Gene Name: small nucleolar RNA, C/D box 19B

There are no transcripts associated with this gene.

Gene: SNORD69
Gene Name: small nucleolar RNA, C/D box 69

There are no transcripts associated with this gene.

Gene: SPCS1
Gene Name: signal peptidase complex subunit 1

There are no transcripts associated with this gene.

View Full Product Details