Product Details

SNP ID: rs6501736
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:74779219 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATATGTCCCCATTTCTTGTATCTCC[A/G]GTTGTTTAAGGGGTCCTCTCACATG
Phenotype: MIM: 604990
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NAT9 PubMed Links

Gene Details

Gene: NAT9
Gene Name: N-acetyltransferase 9 (putative)

There are no transcripts associated with this gene.

Gene: SLC9A3R1
Gene Name: SLC9A3 regulator 1

There are no transcripts associated with this gene.

Gene: TMEM104
Gene Name: transmembrane protein 104

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321264.1		Intron			NP_001308193.1
NM_017728.3		Intron			NP_060198.3
XM_006721963.1		Intron			XP_006722026.1
XM_017024797.1		Intron			XP_016880286.1
XM_017024798.1		Intron			XP_016880287.1
XM_017024799.1		Intron			XP_016880288.1

View Full Product Details