Product Details

SNP ID: rs862707
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.19:57355505 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: AGGCCCATAGTGATTCTTCACATCT[A/G]CTTTACTTTCCTCATTCTTGGCACT
Phenotype: MIM: 613840
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: TRAPPC2B PubMed Links

Gene Details

Gene: TRAPPC2B
Gene Name: trafficking protein particle complex 2B

There are no transcripts associated with this gene.

Gene: ZNF304
Gene Name: zinc finger protein 304

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001290318.1	805	Intron			NP_001277247.1
NM_001290319.1	805	Intron			NP_001277248.1
NM_020657.3	805	Intron			NP_065708.2
XM_011527145.2	805	Intron			XP_011525447.1
XM_017027024.1	805	UTR 5			XP_016882513.1

Gene: ZNF547
Gene Name: zinc finger protein 547

There are no transcripts associated with this gene.

View Full Product Details