Product Details

SNP ID

rs1046196

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.2:189746782 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

CAGATTTTCCTTAGCATGTCTACAG[A/G]AATTTAGTGTCAGGTCAGAGTTATG

Phenotype

MIM: 609803

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

ANKAR PubMed Links

Additional Information

For this assay, SNP(s) [rs201037870,rs80306810] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ANKAR

Gene Name

ankyrin and armadillo repeat containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_144708.3	2690	Intron			NP_653309.3
XM_011510673.2	2690	Intron			XP_011508975.1
XM_011510674.1	2690	Intron			XP_011508976.1
XM_011510675.2	2690	Intron			XP_011508977.1
XM_011510676.2	2690	Intron			XP_011508978.1
XM_011510677.2	2690	Intron			XP_011508979.1
XM_011510679.2	2690	Intron			XP_011508981.1
XM_011510680.1	2690	Intron			XP_011508982.1
XM_011510681.1	2690	Intron			XP_011508983.1
XM_011510682.2	2690	Intron			XP_011508984.1
XM_011510685.2	2690	Intron			XP_011508987.1
XM_011510686.2	2690	Intron			XP_011508988.1
XM_011510687.2	2690	Intron			XP_011508989.1
XM_011510688.1	2690	Intron			XP_011508990.1
XM_011510689.2	2690	Intron			XP_011508991.1
XM_011510691.2	2690	Intron			XP_011508993.1
XM_011510692.2	2690	Intron			XP_011508994.1
XM_011510693.2	2690	Intron			XP_011508995.1
XM_011510694.2	2690	Intron			XP_011508996.1
XM_017003413.1	2690	Intron			XP_016858902.1
XM_017003414.1	2690	Intron			XP_016858903.1
XM_017003415.1	2690	Intron			XP_016858904.1
XM_017003416.1	2690	Intron			XP_016858905.1
XM_017003417.1	2690	Intron			XP_016858906.1
XM_017003418.1	2690	Intron			XP_016858907.1
XM_017003419.1	2690	Intron			XP_016858908.1
XM_017003420.1	2690	Intron			XP_016858909.1

Gene

OSGEPL1

Gene Name

O-sialoglycoprotein endopeptidase-like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022353.2	2690	UTR 3			NP_071748.2
XM_005246766.3	2690	UTR 3			XP_005246823.1
XM_006712685.1	2690	UTR 3			XP_006712748.1
XM_006712686.1	2690	UTR 3			XP_006712749.1
XM_011511631.1	2690	UTR 3			XP_011509933.1
XM_017004676.1	2690	Intron			XP_016860165.1
XM_017004677.1	2690	Intron			XP_016860166.1
XM_017004678.1	2690	UTR 3			XP_016860167.1
XM_017004679.1	2690	Intron			XP_016860168.1
XM_017004680.1	2690	Intron			XP_016860169.1
XM_017004681.1	2690	UTR 3			XP_016860170.1
XM_017004682.1	2690	UTR 3			XP_016860171.1
XM_017004683.1	2690	UTR 3			XP_016860172.1
XM_017004684.1	2690	UTR 3			XP_016860173.1
XM_017004685.1	2690	Intron			XP_016860174.1

View Full Product Details