Product Details

SNP ID: rs1124708
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:125904156 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGGCGTAAAGCGCGGCGGGGAGTC[C/T]GGGGGGCTCCCGCCTGGAGGGCTGT
Phenotype: MIM: 607663 MIM: 610693 MIM: 616283
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DDX25 PubMed Links

Gene Details

Gene: DDX25
Gene Name: DEAD-box helicase 25

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013264.4		Intron			NP_037396.3
XM_011542790.2		Intron			XP_011541092.1
XM_011542791.2		Intron			XP_011541093.1
XM_017017626.1		Intron			XP_016873115.1

Gene: HYLS1
Gene Name: HYLS1, centriolar and ciliogenesis associated

There are no transcripts associated with this gene.

Gene: PUS3
Gene Name: pseudouridylate synthase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271985.1		Intron			NP_001258914.1
NM_031307.3		Intron			NP_112597.3
XM_005271687.3		Intron			XP_005271744.1
XM_005271688.3		Intron			XP_005271745.1

View Full Product Details