Product Details

SNP ID: rs3816051
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:54874148 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTCGGCAACGAACTGTTCCACTTTG[C/T]TGTGAGGCAATAGATGTGGAAATTC
Phenotype: MIM: 147045 MIM: 604947
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FCAR PubMed Links

Gene Details

Gene: FCAR
Gene Name: Fc fragment of IgA receptor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002000.3	56	UTR 5			NP_001991.1
NM_133269.3	56	UTR 5			NP_579803.1
NM_133271.3	56	UTR 5			NP_579805.1
NM_133272.3	56	UTR 5			NP_579806.1
NM_133273.3	56	UTR 5			NP_579807.1
NM_133274.3	56	UTR 5			NP_579808.1
NM_133277.3	56	UTR 5			NP_579811.1
NM_133278.3	56	UTR 5			NP_579812.1
XM_011526625.2	56	Intron			XP_011524927.1
XM_017026473.1	56	Intron			XP_016881962.1
XM_017026474.1	56	Intron			XP_016881963.1

Gene: KIR3DL2
Gene Name: killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 2

There are no transcripts associated with this gene.

View Full Product Details