Product Details

SNP ID: rs1053226
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:471940 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACATAAAACTCTTTAAGAACTCCTC[C/T]TGACTGGTGACTGTCAACACTTGAT
Phenotype: MIM: 608186 MIM: 182307
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: EXOC3 PubMed Links

Gene Details

Gene: EXOC3
Gene Name: exocyst complex component 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_007277.4		Intron			NP_009208.2
XM_011513948.2		Intron			XP_011512250.1
XM_011513949.2		Intron			XP_011512251.1
XM_011513950.2		Intron			XP_011512252.1
XM_011513951.2		Intron			XP_011512253.1
XM_017009000.1		Intron			XP_016864489.1
XM_017009001.1		Intron			XP_016864490.1
XM_017009002.1		Intron			XP_016864491.1
XM_017009003.1		Intron			XP_016864492.1
XM_017009004.1		Intron			XP_016864493.1
XM_017009005.1		Intron			XP_016864494.1
XM_017009006.1		Intron			XP_016864495.1

Gene: LOC100288152
Gene Name: uncharacterized LOC100288152

There are no transcripts associated with this gene.

Gene: PP7080
Gene Name: uncharacterized LOC25845

There are no transcripts associated with this gene.

Gene: SLC9A3
Gene Name: solute carrier family 9 member A3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284351.2		Intron			NP_001271280.1
NM_004174.3		Intron			NP_004165.2

View Full Product Details