Product Details

SNP ID: rs1046027
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.13:49533187 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGTTGACTTGAAGAACCACTTCTTC[C/T]AGTCATATATAGTAGATATGATGAT
Phenotype: MIM: 607796 MIM: 607867
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PHF11 PubMed Links

Gene Details

Gene: PHF11
Gene Name: PHD finger protein 11

There are no transcripts associated with this gene.

Gene: RCBTB1
Gene Name: RCC1 and BTB domain containing protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018191.3	2718	UTR 3			NP_060661.3
XM_005266441.2	2718	UTR 3			XP_005266498.1
XM_011535133.1	2718	UTR 3			XP_011533435.1
XM_011535134.1	2718	UTR 3			XP_011533436.1
XM_011535135.2	2718	UTR 3			XP_011533437.1
XM_011535136.2	2718	Intron			XP_011533438.1

Gene: SETDB2-PHF11
Gene Name: SETDB2-PHF11 readthrough

There are no transcripts associated with this gene.

View Full Product Details