Product Details

SNP ID: rs1049577
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.2:223597187 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TACTATTAAACACAGTCATAGATAT[T/C]TTTCTTGAATAATGGACATAATAAA
Phenotype: MIM: 118930
Polymorphism: T/C, Transition Substitution
Allele Nomenclature
Literature Links: SCG2 PubMed Links
Additional Information: For this assay, SNP(s) [rs16864969] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003469.4	2325	UTR 3			NP_003460.2