Product Details

SNP ID: rs8454
Assay Type: Functionally tested
NCBI dbSNP Submissions: 22
Location: Chr.1:154957128 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAAAAAGTAGTGGAGTGAGAGAGC[A/G]AGAGGGAGCAGATCCAGCAAAAACA
Phenotype: MIM: 606903 MIM: 600560
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC101928120 PubMed Links

Gene Details

Gene: LOC101928120
Gene Name: uncharacterized LOC101928120

There are no transcripts associated with this gene.

Gene: PBXIP1
Gene Name: PBX homeobox interacting protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317734.1	3078	Intron			NP_001304663.1
NM_001317735.1	3078	Intron			NP_001304664.1
NM_020524.3	3078	Intron			NP_065385.2

Gene: PYGO2
Gene Name: pygopus family PHD finger 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_138300.3	3078	UTR 3			NP_612157.1

Gene: SHC1
Gene Name: SHC adaptor protein 1

There are no transcripts associated with this gene.

View Full Product Details