Product Details

SNP ID: rs817340
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:63974671 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGAATCCAGGCCTTCTTGGGAAAG[A/C]AGCAATGGGAAGGCCCACGCACAAG
Phenotype: MIM: 613979
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: PRPF6 PubMed Links

Gene Details

Gene: PRPF6
Gene Name: pre-mRNA processing factor 6

There are no transcripts associated with this gene.

Gene: SAMD10
Gene Name: sterile alpha motif domain containing 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_080621.4	1623	UTR 3			NP_542188.1
XM_005260199.4	1623	UTR 3			XP_005260256.1
XM_006723705.3	1623	UTR 3			XP_006723768.1
XM_011528565.2	1623	UTR 3			XP_011526867.1
XM_017027671.1	1623	UTR 3			XP_016883160.1

Gene: ZNF512B
Gene Name: zinc finger protein 512B

There are no transcripts associated with this gene.

View Full Product Details