Product Details

SNP ID: rs1051183
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:218264178 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTTTAAAATCTTTAACTAGTATCT[C/T]TTCCTCCTTTCCACCCCCAGAGACT
Phenotype: MIM: 603488 MIM: 604224 MIM: 610147 MIM: 609023
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AAMP PubMed Links

Gene Details

Gene: AAMP
Gene Name: angio associated migratory cell protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001087.4	1783	UTR 3			NP_001078.2
NM_001302545.1	1783	UTR 3			NP_001289474.1

Gene: ARPC2
Gene Name: actin related protein 2/3 complex subunit 2

There are no transcripts associated with this gene.

Gene: GPBAR1
Gene Name: G protein-coupled bile acid receptor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077191.1	1783	Intron			NP_001070659.1
NM_001077194.1	1783	Intron			NP_001070662.1
NM_001321950.1	1783	Intron			NP_001308879.1
NM_170699.2	1783	Intron			NP_733800.1
XM_011510743.1	1783	Intron			XP_011509045.1
XM_017003467.1	1783	Intron			XP_016858956.1
XM_017003468.1	1783	Intron			XP_016858957.1
XM_017003469.1	1783	Intron			XP_016858958.1

Gene: PNKD
Gene Name: paroxysmal nonkinesigenic dyskinesia

There are no transcripts associated with this gene.

View Full Product Details