Product Details

SNP ID: rs1800971
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.8:6870594 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GATTCATTTTGGCCCAAAGGAGGTA[C/T]ACTTCAAAAGCAATTTTCCTTTATT
Phenotype: MIM: 602056
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: DEFB1 PubMed Links
Additional Information: For this assay, SNP(s) [rs5743491] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005218.3	444	UTR 3			NP_005209.1