Product Details

SNP ID: rs1043839
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24440075 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGAACAGGCCTCAGGCCCTTGCCA[C/T]GACCTACTTAGGCTACAATTTCCTT
Phenotype: MIM: 616162
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: KHNYN PubMed Links

Gene Details

Gene: KHNYN
Gene Name: KH and NYN domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001290256.1	882	UTR 3			NP_001277185.1
NM_001290257.1	882	UTR 3			NP_001277186.1
NM_015299.2	882	UTR 3			NP_056114.1
XM_005267474.4	882	UTR 3			XP_005267531.1
XM_011536590.2	882	UTR 3			XP_011534892.1
XM_017021114.1	882	Intron			XP_016876603.1

Gene: LOC101927045
Gene Name: uncharacterized LOC101927045

There are no transcripts associated with this gene.

Gene: SDR39U1
Gene Name: short chain dehydrogenase/reductase family 39U member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001290292.1	882	UTR 3			NP_001277221.1
NM_001290293.2	882	UTR 3			NP_001277222.1
NM_001308075.1	882	UTR 3			NP_001295004.1
NM_020195.2	882	UTR 3			NP_064580.2
XM_011536975.1	882	UTR 3			XP_011535277.1
XM_011536976.1	882	UTR 3			XP_011535278.1

View Full Product Details