Product Details

SNP ID: rs8296
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:2658516 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTAGCATAGCCACCCATGTCAGAGG[C/T]TCGAACCTGTGGGGGAGAATCATCA
Phenotype: MIM: 604526 MIM: 614155 MIM: 614154
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: IDH3B PubMed Links

Gene Details

Gene: IDH3B
Gene Name: isocitrate dehydrogenase 3 (NAD(+)) beta

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001258384.2	1113	Intron			NP_001245313.1
NM_006899.4	1113	UTR 3			NP_008830.2
NM_174855.3	1113	Missense Mutation	ACC,GCC	T360A	NP_777280.1
XM_005260716.1	1113	Missense Mutation	AAC,AGC	N386S	XP_005260773.1

Gene: MIR1292
Gene Name: microRNA 1292

There are no transcripts associated with this gene.

Gene: NOP56
Gene Name: NOP56 ribonucleoprotein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006392.3	1113	Intron			NP_006383.2

Gene: SNORA51
Gene Name: small nucleolar RNA, H/ACA box 51

There are no transcripts associated with this gene.

Gene: SNORD110
Gene Name: small nucleolar RNA, C/D box 110

There are no transcripts associated with this gene.

Gene: SNORD56
Gene Name: small nucleolar RNA, C/D box 56

There are no transcripts associated with this gene.

Gene: SNORD57
Gene Name: small nucleolar RNA, C/D box 57

There are no transcripts associated with this gene.

Gene: SNORD86
Gene Name: small nucleolar RNA, C/D box 86

There are no transcripts associated with this gene.

View Full Product Details