Product Details

SNP ID: rs8393
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:41790098 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCTGTAACCATACATTGATGTTAAC[A/C]TAGCATGAAGTTTATTCTTGAAGAA
Phenotype: MIM: 611389 MIM: 616168
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: PRICKLE4 PubMed Links

Gene Details

Gene: PRICKLE4
Gene Name: prickle planar cell polarity protein 4

There are no transcripts associated with this gene.

Gene: TOMM6
Gene Name: translocase of outer mitochondrial membrane 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134493.1	8604	Intron			NP_001127965.1

Gene: USP49
Gene Name: ubiquitin specific peptidase 49

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286554.1	8604	UTR 3			NP_001273483.1
NM_018561.4	8604	Intron			NP_061031.2

View Full Product Details