Product Details

SNP ID

rs11971338

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.7:94909783 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TTTTAACTTCCCATTTCAATGAGTA[A/G]TCTCTTCTGTTTGCCACGTGGCTAA

Phenotype

MIM: 602468

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

PPP1R9A PubMed Links

Additional Information

For this assay, SNP(s) [rs368119507] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

PPP1R9A

Gene Name

protein phosphatase 1 regulatory subunit 9A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001166160.1		Intron			NP_001159632.1
NM_001166161.1		Intron			NP_001159633.1
NM_001166162.1		Intron			NP_001159634.1
NM_001166163.1		Intron			NP_001159635.1
NM_017650.2		Intron			NP_060120.2
XM_011516380.1		Intron			XP_011514682.1
XM_011516381.1		Intron			XP_011514683.1
XM_011516382.2		Intron			XP_011514684.1
XM_011516383.1		Intron			XP_011514685.1
XM_011516389.1		Intron			XP_011514691.1
XM_017012394.1		Intron			XP_016867883.1
XM_017012395.1		Intron			XP_016867884.1
XM_017012396.1		Intron			XP_016867885.1
XM_017012397.1		Intron			XP_016867886.1
XM_017012398.1		Intron			XP_016867887.1
XM_017012399.1		Intron			XP_016867888.1
XM_017012400.1		Intron			XP_016867889.1
XM_017012401.1		Intron			XP_016867890.1
XM_017012402.1		Intron			XP_016867891.1
XM_017012403.1		Intron			XP_016867892.1
XM_017012404.1		Intron			XP_016867893.1
XM_017012405.1		Intron			XP_016867894.1
XM_017012406.1		Intron			XP_016867895.1
XM_017012407.1		Intron			XP_016867896.1
XM_017012408.1		Intron			XP_016867897.1
XM_017012409.1		Intron			XP_016867898.1
XM_017012410.1		Intron			XP_016867899.1
XM_017012411.1		Intron			XP_016867900.1

View Full Product Details