Product Details

SNP ID

rs1263

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.2:215360620 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

TCTGAACGGTAAACTAGCAATTTTA[A/G]TAAATATTGGGGTCCACTTAAATCT

Phenotype

MIM: 601731 MIM: 135600

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

ATIC PubMed Links

Additional Information

For this assay, SNP(s) [rs144733264,rs73089349] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ATIC

Gene Name

5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004044.6	8092	Intron			NP_004035.2
XM_017004187.1	8092	Intron			XP_016859676.1

Gene

FN1

Gene Name

fibronectin 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001306129.1	8092	UTR 3			NP_001293058.1
NM_001306130.1	8092	UTR 3			NP_001293059.1
NM_001306131.1	8092	UTR 3			NP_001293060.1
NM_001306132.1	8092	UTR 3			NP_001293061.1
NM_002026.3	8092	UTR 3			NP_002017.1
NM_054034.2	8092	Intron			NP_473375.2
NM_212474.2	8092	UTR 3			NP_997639.1
NM_212476.2	8092	UTR 3			NP_997641.1
NM_212478.2	8092	UTR 3			NP_997643.1
NM_212482.2	8092	UTR 3			NP_997647.1
XM_005246397.1	8092	Intron			XP_005246454.1
XM_005246398.1	8092	Intron			XP_005246455.1
XM_005246399.1	8092	Intron			XP_005246456.1
XM_005246401.1	8092	Intron			XP_005246458.1
XM_005246402.1	8092	Intron			XP_005246459.1
XM_005246403.1	8092	Intron			XP_005246460.1
XM_005246404.1	8092	Intron			XP_005246461.1
XM_005246405.1	8092	Intron			XP_005246462.1
XM_005246406.1	8092	Intron			XP_005246463.1
XM_005246407.1	8092	Intron			XP_005246464.1
XM_005246408.1	8092	Intron			XP_005246465.1
XM_005246409.1	8092	Intron			XP_005246466.1
XM_005246410.1	8092	Intron			XP_005246467.1
XM_005246411.1	8092	Intron			XP_005246468.1
XM_005246412.1	8092	Intron			XP_005246469.1
XM_005246414.1	8092	Intron			XP_005246471.1
XM_005246416.1	8092	Intron			XP_005246473.1
XM_017003692.1	8092	Intron			XP_016859181.1
XM_017003693.1	8092	Intron			XP_016859182.1
XM_017003694.1	8092	Intron			XP_016859183.1
XM_017003695.1	8092	Intron			XP_016859184.1

View Full Product Details