Product Details

SNP ID: rs384037
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.11:2891323 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CACAGACACAGGGGTCCCAGGCCCA[A/G]TGGCTCACTTTATCAGGGAAACAGC
Phenotype: MIM: 600856 MIM: 602631 MIM: 603240
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CDKN1C PubMed Links

Gene Details

Gene: CDKN1C
Gene Name: cyclin dependent kinase inhibitor 1C

There are no transcripts associated with this gene.

Gene: SLC22A18
Gene Name: solute carrier family 22 member 18

There are no transcripts associated with this gene.

Gene: SLC22A18AS
Gene Name: solute carrier family 22 member 18 antisense

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001302862.1		Intron			NP_001289791.1
NM_007105.3		Intron			NP_009036.2
XM_017017832.1		Intron			XP_016873321.1
XM_017017833.1		Intron			XP_016873322.1
XM_017017834.1		Intron			XP_016873323.1
XM_017017835.1		Intron			XP_016873324.1
XM_017017836.1		Intron			XP_016873325.1

View Full Product Details