Product Details

SNP ID: rs325701
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:6235026 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTTTACAGGCAGGGAAAGATCAGA[A/C]GGGCGGGGCTTGGGAGAGATGGAGC
Phenotype: MIM: 609472
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: C11orf42 PubMed Links

Gene Details

Gene: C11orf42
Gene Name: chromosome 11 open reading frame 42

There are no transcripts associated with this gene.

Gene: CNGA4
Gene Name: cyclic nucleotide gated channel alpha 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001037329.3		Intron			NP_001032406.1
XM_017017217.1		Intron			XP_016872706.1
XM_017017218.1		Intron			XP_016872707.1
XM_017017219.1		Intron			XP_016872708.1

Gene: FAM160A2
Gene Name: family with sequence similarity 160 member A2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098794.1		Intron			NP_001092264.1
NM_032127.3		Intron			NP_115503.2
XM_006718343.2		Intron			XP_006718406.1
XM_011520397.2		Intron			XP_011518699.1
XM_011520398.2		Intron			XP_011518700.1
XM_011520399.2		Intron			XP_011518701.1

View Full Product Details