Product Details

SNP ID: rs606567
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:125116196 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AATATTCATCTGATGTTATAGACCA[A/G]TGGTTGCCAAACTATATGGCCTGTG
Phenotype: MIM: 613066
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KRT18P59 PubMed Links

Gene Details

Gene: KRT18P59
Gene Name: keratin 18 pseudogene 59

There are no transcripts associated with this gene.

Gene: PKNOX2
Gene Name: PBX/knotted 1 homeobox 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022062.2		Intron			NP_071345.2
XM_005271642.2		Intron			XP_005271699.1
XM_005271643.2		Intron			XP_005271700.1
XM_006718894.2		Intron			XP_006718957.1
XM_011542944.2		Intron			XP_011541246.1
XM_011542945.2		Intron			XP_011541247.1
XM_011542946.1		Intron			XP_011541248.1
XM_011542947.2		Intron			XP_011541249.1
XM_017018110.1		Intron			XP_016873599.1
XM_017018111.1		Intron			XP_016873600.1
XM_017018112.1		Intron			XP_016873601.1

Gene: TMEM218
Gene Name: transmembrane protein 218

There are no transcripts associated with this gene.

View Full Product Details