Product Details

SNP ID: rs414528
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.19:17219251 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TCCCAGCCAGTGAGTGAGAAGCAGT[C/T]GGCAGCTGAGCTAGACCTCGTCCTG
Phenotype: MIM: 602129 MIM: 610675
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MYO9B PubMed Links

Gene Details

Gene: MYO9B
Gene Name: myosin IXB

There are no transcripts associated with this gene.

Gene: OCEL1
Gene Name: occludin/ELL domain containing 1

There are no transcripts associated with this gene.

Gene: USE1
Gene Name: unconventional SNARE in the ER 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018467.3	521	Missense Mutation	TCG,TTG	S154L	NP_060937.1
XM_017026975.1	521	Missense Mutation	TCG,TTG	S154L	XP_016882464.1
XM_017026976.1	521	Missense Mutation	TCG,TTG	S84L	XP_016882465.1

View Full Product Details