Product Details

SNP ID: rs11811122
Assay Type: Functionally tested
NCBI dbSNP Submissions: 33
Location: Chr.1:2414527 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCCGAGGGTCCTTCCTGAGGGCGAC[T/G]TGAATACGGCGGTCCTATCCTGGGA
Phenotype: MIM: 602859 MIM: 612836
Polymorphism: T/G, Transversion substitution
Allele Nomenclature
Literature Links: PEX10 PubMed Links

Gene Details

Gene: PEX10
Gene Name: peroxisomal biogenesis factor 10

There are no transcripts associated with this gene.

Gene: PLCH2
Gene Name: phospholipase C eta 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303012.1		Intron			NP_001289941.1
NM_001303013.1		Intron			NP_001289942.1
NM_014638.3		Intron			NP_055453.2
XM_011542455.2		Intron			XP_011540757.1
XM_011542456.2		Intron			XP_011540758.1
XM_017002870.1		Intron			XP_016858359.1
XM_017002871.1		Intron			XP_016858360.1
XM_017002872.1		Intron			XP_016858361.1
XM_017002873.1		Intron			XP_016858362.1
XM_017002874.1		Intron			XP_016858363.1

Gene: RER1
Gene Name: retention in endoplasmic reticulum sorting receptor 1

There are no transcripts associated with this gene.

View Full Product Details