Product Details

SNP ID

rs76228684

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.3:47851764 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGGGAAGCAGATAGCCTTAGTCTCA[G/T]GCCTTTTATTTTTAAATTTCCAGAC

Phenotype

MIM: 616423 MIM: 157132

Polymorphism

G/T, Transversion substitution

Allele Nomenclature

Literature Links

DHX30 PubMed Links

Gene Details

Gene

DHX30

Gene Name

DEAH-box helicase 30

There are no transcripts associated with this gene.

Gene

MAP4

Gene Name

microtubule associated protein 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134364.1	5297	UTR 3			NP_001127836.1
NM_002375.4	5297	UTR 3			NP_002366.2
NM_030885.3	5297	Intron			NP_112147.2
XM_005265133.4	5297	UTR 3			XP_005265190.1
XM_005265134.4	5297	UTR 3			XP_005265191.1
XM_005265155.4	5297	UTR 3			XP_005265212.1
XM_005265157.4	5297	UTR 3			XP_005265214.1
XM_005265158.2	5297	UTR 3			XP_005265215.1
XM_006713146.3	5297	UTR 3			XP_006713209.1
XM_006713147.3	5297	UTR 3			XP_006713210.1
XM_006713152.3	5297	UTR 3			XP_006713215.1
XM_011533703.2	5297	UTR 3			XP_011532005.1
XM_011533704.2	5297	UTR 3			XP_011532006.1
XM_011533705.1	5297	UTR 3			XP_011532007.1
XM_011533708.2	5297	UTR 3			XP_011532010.1
XM_011533709.2	5297	UTR 3			XP_011532011.1
XM_011533710.2	5297	UTR 3			XP_011532012.1
XM_011533718.1	5297	UTR 3			XP_011532020.1
XM_011533719.2	5297	UTR 3			XP_011532021.1
XM_017006391.1	5297	UTR 3			XP_016861880.1
XM_017006392.1	5297	UTR 3			XP_016861881.1
XM_017006393.1	5297	UTR 3			XP_016861882.1
XM_017006394.1	5297	UTR 3			XP_016861883.1
XM_017006395.1	5297	UTR 3			XP_016861884.1
XM_017006396.1	5297	UTR 3			XP_016861885.1
XM_017006397.1	5297	UTR 3			XP_016861886.1
XM_017006398.1	5297	UTR 3			XP_016861887.1
XM_017006399.1	5297	UTR 3			XP_016861888.1
XM_017006400.1	5297	UTR 3			XP_016861889.1
XM_017006401.1	5297	UTR 3			XP_016861890.1
XM_017006402.1	5297	UTR 3			XP_016861891.1
XM_017006403.1	5297	UTR 3			XP_016861892.1
XM_017006404.1	5297	UTR 3			XP_016861893.1
XM_017006405.1	5297	UTR 3			XP_016861894.1
XM_017006406.1	5297	UTR 3			XP_016861895.1
XM_017006407.1	5297	UTR 3			XP_016861896.1
XM_017006408.1	5297	UTR 3			XP_016861897.1
XM_017006409.1	5297	UTR 3			XP_016861898.1
XM_017006410.1	5297	UTR 3			XP_016861899.1
XM_017006411.1	5297	UTR 3			XP_016861900.1
XM_017006412.1	5297	UTR 3			XP_016861901.1
XM_017006413.1	5297	UTR 3			XP_016861902.1
XM_017006414.1	5297	UTR 3			XP_016861903.1
XM_017006415.1	5297	UTR 3			XP_016861904.1
XM_017006416.1	5297	UTR 3			XP_016861905.1
XM_017006417.1	5297	UTR 3			XP_016861906.1
XM_017006418.1	5297	UTR 3			XP_016861907.1
XM_017006419.1	5297	UTR 3			XP_016861908.1
XM_017006420.1	5297	UTR 3			XP_016861909.1
XM_017006421.1	5297	UTR 3			XP_016861910.1
XM_017006422.1	5297	UTR 3			XP_016861911.1

Gene

MIR1226

Gene Name

microRNA 1226

There are no transcripts associated with this gene.

View Full Product Details