Product Details

SNP ID
rs113873576
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.2:189676919 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CTCCAGCTTATTATGATACCAGAAT[C/T]GGGCAAATTCTGATCAATATTGACT
Phenotype
MIM: 609803
Polymorphism
C/T, Transition substitution
Allele Nomenclature
Literature Links
ANKAR PubMed Links

Gene Details

Gene
ANKAR
Gene Name
ankyrin and armadillo repeat containing
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_144708.3 1003 Silent Mutation ATC,ATT I143I NP_653309.3
XM_011510673.2 1003 Silent Mutation ATC,ATT I143I XP_011508975.1
XM_011510674.1 1003 Silent Mutation ATC,ATT I143I XP_011508976.1
XM_011510675.2 1003 Silent Mutation ATC,ATT I143I XP_011508977.1
XM_011510676.2 1003 Silent Mutation ATC,ATT I143I XP_011508978.1
XM_011510677.2 1003 Silent Mutation ATC,ATT I143I XP_011508979.1
XM_011510679.2 1003 Silent Mutation ATC,ATT I143I XP_011508981.1
XM_011510680.1 1003 Silent Mutation ATC,ATT I143I XP_011508982.1
XM_011510681.1 1003 Silent Mutation ATC,ATT I143I XP_011508983.1
XM_011510682.2 1003 Silent Mutation ATC,ATT I143I XP_011508984.1
XM_011510685.2 1003 UTR 5 XP_011508987.1
XM_011510686.2 1003 Silent Mutation ATC,ATT I143I XP_011508988.1
XM_011510687.2 1003 Intron XP_011508989.1
XM_011510688.1 1003 Silent Mutation ATC,ATT I143I XP_011508990.1
XM_011510689.2 1003 Silent Mutation ATC,ATT I143I XP_011508991.1
XM_011510691.2 1003 Intron XP_011508993.1
XM_011510692.2 1003 Intron XP_011508994.1
XM_011510693.2 1003 Intron XP_011508995.1
XM_011510694.2 1003 Intron XP_011508996.1
XM_017003413.1 1003 Silent Mutation ATC,ATT I143I XP_016858902.1
XM_017003414.1 1003 Silent Mutation ATC,ATT I143I XP_016858903.1
XM_017003415.1 1003 Intron XP_016858904.1
XM_017003416.1 1003 UTR 5 XP_016858905.1
XM_017003417.1 1003 Silent Mutation ATC,ATT I143I XP_016858906.1
XM_017003418.1 1003 Intron XP_016858907.1
XM_017003419.1 1003 Intron XP_016858908.1
XM_017003420.1 1003 Intron XP_016858909.1
Gene
ASNSD1
Gene Name
asparagine synthetase domain containing 1
There are no transcripts associated with this gene.

View Full Product Details