Product Details
- SNP ID
-
rs115194365
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:39502948 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CGTACCGCGCGCGCTGCGAGCCGCC[C/T]GCCGTCGGGACCGCGTGCACGCGCC
- Phenotype
-
MIM: 602768
MIM: 607381
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
DLL3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs8106337] are located under a probe and SNP(s) [rs8107127] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- DLL3
- Gene Name
- delta like canonical Notch ligand 3
- Gene
- TIMM50
- Gene Name
- translocase of inner mitochondrial membrane 50
There are no transcripts associated with this gene.
View Full Product Details