Product Details

SNP ID
rs111476617
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.3:47852661 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GGCGCAGTGATGGGGCAAGACCAAA[A/G]CAGGGAGATGGGCCCAGGCTGGGGA
Phenotype
MIM: 616423 MIM: 157132
Polymorphism
A/G, Transition substitution
Allele Nomenclature
Literature Links
DHX30 PubMed Links

Gene Details

Gene
DHX30
Gene Name
DEAH-box helicase 30
There are no transcripts associated with this gene.

Gene
MAP4
Gene Name
microtubule associated protein 4
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001134364.1 4400 UTR 3 NP_001127836.1
NM_002375.4 4400 UTR 3 NP_002366.2
NM_030885.3 4400 Intron NP_112147.2
XM_005265133.4 4400 UTR 3 XP_005265190.1
XM_005265134.4 4400 UTR 3 XP_005265191.1
XM_005265155.4 4400 UTR 3 XP_005265212.1
XM_005265157.4 4400 UTR 3 XP_005265214.1
XM_005265158.2 4400 UTR 3 XP_005265215.1
XM_006713146.3 4400 UTR 3 XP_006713209.1
XM_006713147.3 4400 UTR 3 XP_006713210.1
XM_006713152.3 4400 UTR 3 XP_006713215.1
XM_011533703.2 4400 UTR 3 XP_011532005.1
XM_011533704.2 4400 UTR 3 XP_011532006.1
XM_011533705.1 4400 UTR 3 XP_011532007.1
XM_011533708.2 4400 UTR 3 XP_011532010.1
XM_011533709.2 4400 UTR 3 XP_011532011.1
XM_011533710.2 4400 UTR 3 XP_011532012.1
XM_011533718.1 4400 UTR 3 XP_011532020.1
XM_011533719.2 4400 UTR 3 XP_011532021.1
XM_017006391.1 4400 UTR 3 XP_016861880.1
XM_017006392.1 4400 UTR 3 XP_016861881.1
XM_017006393.1 4400 UTR 3 XP_016861882.1
XM_017006394.1 4400 UTR 3 XP_016861883.1
XM_017006395.1 4400 UTR 3 XP_016861884.1
XM_017006396.1 4400 UTR 3 XP_016861885.1
XM_017006397.1 4400 UTR 3 XP_016861886.1
XM_017006398.1 4400 UTR 3 XP_016861887.1
XM_017006399.1 4400 UTR 3 XP_016861888.1
XM_017006400.1 4400 UTR 3 XP_016861889.1
XM_017006401.1 4400 UTR 3 XP_016861890.1
XM_017006402.1 4400 UTR 3 XP_016861891.1
XM_017006403.1 4400 UTR 3 XP_016861892.1
XM_017006404.1 4400 UTR 3 XP_016861893.1
XM_017006405.1 4400 UTR 3 XP_016861894.1
XM_017006406.1 4400 UTR 3 XP_016861895.1
XM_017006407.1 4400 UTR 3 XP_016861896.1
XM_017006408.1 4400 UTR 3 XP_016861897.1
XM_017006409.1 4400 UTR 3 XP_016861898.1
XM_017006410.1 4400 UTR 3 XP_016861899.1
XM_017006411.1 4400 UTR 3 XP_016861900.1
XM_017006412.1 4400 UTR 3 XP_016861901.1
XM_017006413.1 4400 UTR 3 XP_016861902.1
XM_017006414.1 4400 UTR 3 XP_016861903.1
XM_017006415.1 4400 UTR 3 XP_016861904.1
XM_017006416.1 4400 UTR 3 XP_016861905.1
XM_017006417.1 4400 UTR 3 XP_016861906.1
XM_017006418.1 4400 UTR 3 XP_016861907.1
XM_017006419.1 4400 UTR 3 XP_016861908.1
XM_017006420.1 4400 UTR 3 XP_016861909.1
XM_017006421.1 4400 UTR 3 XP_016861910.1
XM_017006422.1 4400 UTR 3 XP_016861911.1
Gene
MIR1226
Gene Name
microRNA 1226
There are no transcripts associated with this gene.

View Full Product Details