Product Details

SNP ID: rs141859450
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:68041361 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTACACCTGCGTGAGTCGGCTGGG[C/T]GAGCTGGGCCTCGTGGAGTTCAGAG
Phenotype: MIM: 602141 MIM: 604592
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIR4691 PubMed Links

Gene Details

Gene: MIR4691
Gene Name: microRNA 4691

There are no transcripts associated with this gene.

Gene: MIR6753
Gene Name: microRNA 6753

There are no transcripts associated with this gene.

Gene: MIR7113
Gene Name: microRNA 7113

There are no transcripts associated with this gene.

Gene: NDUFS8
Gene Name: NADH:ubiquinone oxidoreductase core subunit S8

There are no transcripts associated with this gene.

Gene: TCIRG1
Gene Name: T-cell immune regulator 1, ATPase H+ transporting V0 subunit a3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006019.3	214	Silent Mutation	GGC,GGT	G30G	NP_006010.2
NM_006053.3	214	Intron			NP_006044.1
XM_005273709.3	214	Silent Mutation	GGC,GGT	G30G	XP_005273766.1
XM_011544726.2	214	Silent Mutation	GGC,GGT	G30G	XP_011543028.1
XM_017017089.1	214	Silent Mutation	GGC,GGT	G30G	XP_016872578.1
XM_017017090.1	214	UTR 5			XP_016872579.1

View Full Product Details