Product Details
- SNP ID
-
rs148773342
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.13:113822039 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCCAGCCTCTCCTGCAGCTGCGCGG[C/T]GCTCACCTCGCTCTGGCCCCTGGTG
- Phenotype
-
MIM: 600441
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
GAS6
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs7400002] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- GAS6
- Gene Name
- growth arrest specific 6
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_000820.3 |
1984 |
Missense Mutation |
ACC,GCC |
T601A |
NP_000811.1 |
- Gene
- GAS6-AS1
- Gene Name
- GAS6 antisense RNA 1
There are no transcripts associated with this gene.
- Gene
- TMEM255B
- Gene Name
- transmembrane protein 255B
There are no transcripts associated with this gene.
View Full Product Details