Product Details
- SNP ID
-
rs148453374
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.15:63597738 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGTCAATGATTTCCTCCTCCGGGTG[A/T]GCGACAGGTAGGCCACCTTGCCTCC
- Phenotype
-
MIM: 609088
MIM: 604728
- Polymorphism
- A/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
FBXL22
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs8035931] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- FBXL22
- Gene Name
- F-box and leucine rich repeat protein 22
- Gene
- USP3
- Gene Name
- ubiquitin specific peptidase 3
There are no transcripts associated with this gene.
- Gene
- USP3-AS1
- Gene Name
- USP3 antisense RNA 1
There are no transcripts associated with this gene.
View Full Product Details