Product Details

SNP ID: rs149604812
Assay Type: Functionally tested
NCBI dbSNP Submissions: 12
Location: Chr.1:27960345 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCTGGCGCTGCTGCATCTCCTGCA[A/G]CTGGGTTACCTGTACAGGTGAGTGC
Phenotype: MIM: 601655
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EYA3 PubMed Links

Gene Details

Gene: EYA3
Gene Name: EYA transcriptional coactivator and phosphatase 3

There are no transcripts associated with this gene.

Gene: SMPDL3B
Gene Name: sphingomyelin phosphodiesterase acid like 3B

There are no transcripts associated with this gene.

Gene: XKR8
Gene Name: XK related 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018053.3	884	Silent Mutation	CAA,CAG	Q92Q	NP_060523.2
XM_011541679.2	884	Missense Mutation	AAC,AGC	N56S	XP_011539981.1
XM_011541680.2	884	Missense Mutation	AAC,AGC	N56S	XP_011539982.1

View Full Product Details