Product Details

SNP ID: rs149644767
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31729122 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCTCTGGGACTCCCCGGATCAGGG[A/C]ATGGGAGCAGCGGCCCAGCCCCTCC
Phenotype: MIM: 606520 MIM: 602872 MIM: 604744 MIM: 610435
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: C6orf25 PubMed Links

Gene Details

Gene: C6orf25
Gene Name: chromosome 6 open reading frame 25

There are no transcripts associated with this gene.

Gene: CLIC1
Gene Name: chloride intracellular channel 1

There are no transcripts associated with this gene.

Gene: DDAH2
Gene Name: dimethylarginine dimethylaminohydrolase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303007.1	244	Missense Mutation	GCC,TCC	A14S	NP_001289936.1
NM_001303008.1	244	Missense Mutation	GCC,TCC	A14S	NP_001289937.1
NM_013974.2	244	Missense Mutation	GCC,TCC	A14S	NP_039268.1
XM_011514448.2	244	Missense Mutation	GCC,TCC	A14S	XP_011512750.1

Gene: LY6G6C
Gene Name: lymphocyte antigen 6 complex, locus G6C

There are no transcripts associated with this gene.

View Full Product Details