Product Details

SNP ID: rs138914544
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:137079275 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGCAGGTGGTGGAAAAGGCATACC[C/T]CGAGGAGCCCGTGGGCGTGGTGTGC
Phenotype: MIM: 604346 MIM: 612057
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MAN1B1 PubMed Links

Gene Details

Gene: MAN1B1
Gene Name: mannosidase alpha class 1B member 1

There are no transcripts associated with this gene.

Gene: MAN1B1-AS1
Gene Name: MAN1B1 antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: SAPCD2
Gene Name: suppressor APC domain containing 2

There are no transcripts associated with this gene.

Gene: UAP1L1
Gene Name: UDP-N-acetylglucosamine pyrophosphorylase 1 like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_207309.2	921	Missense Mutation	CCC,CTC	P288L	NP_997192.2
XM_006717317.3	921	Missense Mutation	CCC,CTC	P288L	XP_006717380.1
XM_011519182.2	921	Missense Mutation	CCC,CTC	P121L	XP_011517484.1

View Full Product Details