Product Details

SNP ID: rs145461866
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:137030944 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATGCACGAAGGCGTCAGCCGGCAC[A/G]AAGGCCTCATAGGTGGCCCGTGGGG
Phenotype: MIM: 600047 MIM: 602030 MIM: 605798
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ABCA2 PubMed Links

Gene Details

Gene: ABCA2
Gene Name: ATP binding cassette subfamily A member 2

There are no transcripts associated with this gene.

Gene: C9orf139
Gene Name: chromosome 9 open reading frame 139

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_207511.2	1644	Intron			NP_997394.1
XM_017014717.1	1644	Intron			XP_016870206.1

Gene: FUT7
Gene Name: fucosyltransferase 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004479.3	1644	Silent Mutation	TTC,TTT	F265F	NP_004470.1

Gene: NPDC1
Gene Name: neural proliferation, differentiation and control 1

There are no transcripts associated with this gene.

View Full Product Details