Product Details
- SNP ID
-
rs185263154
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
6
- Location
-
Chr.1:1072053 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CGGGGGGCAGGGTCCCGGGCGGGCG[C/T]GGGCGGCTCGGCAGGCTTGCTCAAA
- Phenotype
-
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
C1orf159
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs4333796] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C1orf159
- Gene Name
- chromosome 1 open reading frame 159
There are no transcripts associated with this gene.
- Gene
- LOC100288175
- Gene Name
- uncharacterized LOC100288175
There are no transcripts associated with this gene.
- Gene
- LOC105378948
- Gene Name
- uncharacterized LOC105378948
There are no transcripts associated with this gene.
- Gene
- RNF223
- Gene Name
- ring finger protein 223
View Full Product Details