Product Details

SNP ID: rs201675155
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:140645634 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCTCCAGGGCTCTGGTTACCTGAT[C/T]AGCACTGAAGTTGTTCAAAGGGACA
Phenotype: MIM: 600549 MIM: 602137
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: IK PubMed Links

Gene Details

Gene: IK
Gene Name: IK cytokine, down-regulator of HLA II

There are no transcripts associated with this gene.

Gene: MIR3655
Gene Name: microRNA 3655

There are no transcripts associated with this gene.

Gene: NDUFA2
Gene Name: NADH:ubiquinone oxidoreductase subunit A2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001185012.1	455	UTR 3			NP_001171941.1
NM_002488.4	455	Missense Mutation	AAT,GAT	N85D	NP_002479.1

Gene: TMCO6
Gene Name: transmembrane and coiled-coil domains 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300980.1	455	Intron			NP_001287909.1
NM_001300982.1	455	Intron			NP_001287911.1
NM_018502.4	455	Intron			NP_060972.3
XM_005268477.1	455	Intron			XP_005268534.1
XM_011537663.2	455	Intron			XP_011535965.1
XM_011537665.2	455	Intron			XP_011535967.1
XM_011537668.2	455	Intron			XP_011535970.1
XM_017009617.1	455	Intron			XP_016865106.1
XM_017009618.1	455	Intron			XP_016865107.1
XM_017009619.1	455	Intron			XP_016865108.1
XM_017009620.1	455	Intron			XP_016865109.1

View Full Product Details