Product Details

SNP ID
rs4681678
Assay Type
Validated
NCBI dbSNP Submissions
NA
Location
Chr.3:58342172 on Build GRCh38
Set Membership
HapMap Validated
Context Sequence [VIC/FAM]
TATTGTTATCGGAATTGTTTCAGAA[A/T]GTATTCTAAGCACAAGTTCTTTAGC
Phenotype
MIM: 611450
Polymorphism
A/T, Transversion Substitution
Allele Nomenclature
Literature Links
PXK PubMed Links
Additional Information
For this assay, SNP(s) [rs55870916] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
PXK
Gene Name
PX domain containing serine/threonine kinase like
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001289095.1 Intron NP_001276024.1
NM_001289096.1 Intron NP_001276025.1
NM_001289098.1 Intron NP_001276027.1
NM_001289099.1 Intron NP_001276028.1
NM_001289100.1 Intron NP_001276029.1
NM_001289101.1 Intron NP_001276030.1
NM_017771.4 Intron NP_060241.2
XM_005265250.4 Intron XP_005265307.1
XM_005265252.4 Intron XP_005265309.1
XM_005265255.3 Intron XP_005265312.1
XM_005265256.3 Intron XP_005265313.1
XM_017006671.1 Intron XP_016862160.1
XM_017006672.1 Intron XP_016862161.1
XM_017006673.1 Intron XP_016862162.1
XM_017006674.1 Intron XP_016862163.1
XM_017006675.1 Intron XP_016862164.1
XM_017006676.1 Intron XP_016862165.1
XM_017006677.1 Intron XP_016862166.1
XM_017006678.1 Intron XP_016862167.1
XM_017006679.1 Intron XP_016862168.1
XM_017006680.1 Intron XP_016862169.1
XM_017006681.1 Intron XP_016862170.1
XM_017006682.1 Intron XP_016862171.1
XM_017006683.1 Intron XP_016862172.1
XM_017006684.1 Intron XP_016862173.1
XM_017006685.1 Intron XP_016862174.1
XM_017006686.1 Intron XP_016862175.1
XM_017006687.1 Intron XP_016862176.1
XM_017006688.1 Intron XP_016862177.1
XM_017006689.1 Intron XP_016862178.1
XM_017006690.1 Intron XP_016862179.1
XM_017006691.1 Intron XP_016862180.1
XM_017006692.1 Intron XP_016862181.1
XM_017006693.1 Intron XP_016862182.1
XM_017006694.1 Intron XP_016862183.1
XM_017006695.1 Intron XP_016862184.1
XM_017006696.1 Intron XP_016862185.1
XM_017006697.1 Intron XP_016862186.1
XM_017006698.1 Intron XP_016862187.1
XM_017006699.1 Intron XP_016862188.1
XM_017006700.1 Intron XP_016862189.1
XM_017006701.1 Intron XP_016862190.1
XM_017006702.1 Intron XP_016862191.1
XM_017006703.1 Intron XP_016862192.1
XM_017006704.1 Intron XP_016862193.1

View Full Product Details