Product Details

SNP ID: rs2321048
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:25425076 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AATAAATAGCAAATGTATAAGAGCA[C/T]TCATTACAATAGCCATGCAAAGTGG
Phenotype: MIM: 616904 MIM: 152760
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DOCK5 PubMed Links

Gene Details

Gene: DOCK5
Gene Name: dedicator of cytokinesis 5

There are no transcripts associated with this gene.

Gene: GNRH1
Gene Name: gonadotropin releasing hormone 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000825.3		Intron			NP_000816.4
NM_001083111.1		Intron			NP_001076580.1

Gene: KCTD9
Gene Name: potassium channel tetramerization domain containing 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017634.3		Intron			NP_060104.2

View Full Product Details