Product Details

SNP ID: rs59643945
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:48627040 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGGCTGTTGCATCTTCCATCTTAT[C/T]TCCTGAGCTCACCTGCTGGGGAGCC
Phenotype: MIM: 604264 MIM: 610068
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CELSR3 PubMed Links

Gene Details

Gene: CELSR3
Gene Name: cadherin EGF LAG seven-pass G-type receptor 3

There are no transcripts associated with this gene.

Gene: MIR6824
Gene Name: microRNA 6824

There are no transcripts associated with this gene.

Gene: SLC26A6
Gene Name: solute carrier family 26 member 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040454.1	2009	Missense Mutation	AAT,GAT	N616D	NP_001035544.1
NM_001281732.1	2009	Missense Mutation	AAT,GAT	N601D	NP_001268661.1
NM_001281733.1	2009	Missense Mutation	AAT,GAT	N529D	NP_001268662.1
NM_022911.2	2009	Missense Mutation	AAT,GAT	N637D	NP_075062.2
NM_134263.2	2009	Missense Mutation	AAT,GAT	N636D	NP_599025.2
NM_134426.2	2009	Missense Mutation	AAT,GAT	N618D	NP_602298.2

Gene: TMEM89
Gene Name: transmembrane protein 89

There are no transcripts associated with this gene.

View Full Product Details