Product Details

SNP ID: rs3813457
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:154398100 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTGTCACAGTTAACGGCAAAGCCTA[A/G]GGCAAGAGTTCTACGCCCAAGATGG
Phenotype: MIM: 300081 MIM: 312173
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DNASE1L1 PubMed Links

Gene Details

Gene: DNASE1L1
Gene Name: deoxyribonuclease I-like 1

There are no transcripts associated with this gene.

Gene: LOC107987332
Gene Name: uncharacterized LOC107987332

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017030021.1	36	Silent Mutation	TAA,TAG	325	XP_016885510.1

Gene: RPL10
Gene Name: ribosomal protein L10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256577.2	36	UTR 5			NP_001243506.2
NM_001256580.2	36	UTR 5			NP_001243509.2
NM_001303624.1	36	Intron			NP_001290553.1
NM_001303625.1	36	UTR 5			NP_001290554.1
NM_001303626.1	36	Intron			NP_001290555.1
NM_006013.4	36	UTR 5			NP_006004.3

Gene: SNORA70
Gene Name: small nucleolar RNA, H/ACA box 70

There are no transcripts associated with this gene.

View Full Product Details