Product Details

SNP ID: rs192136138
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:27919661 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACCGACACCTCACCTCCATAGTCC[A/T]CATAAAAGACTCCTGACAGGTTCTG
Phenotype: MIM: 606876
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: MIR3199-1 PubMed Links

Gene Details

Gene: MIR3199-1
Gene Name: microRNA 3199-1

There are no transcripts associated with this gene.

Gene: MIR3199-2
Gene Name: microRNA 3199-2

There are no transcripts associated with this gene.

Gene: PITPNB
Gene Name: phosphatidylinositol transfer protein beta

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284277.1		Intron			NP_001271206.1
NM_001284278.1		Intron			NP_001271207.1
NM_012399.4		Intron			NP_036531.1
XM_011530052.2		Intron			XP_011528354.1
XM_017028707.1		Intron			XP_016884196.1

Gene: TTC28-AS1
Gene Name: TTC28 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details