Product Details

SNP ID
rs2361116
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.8:52117859 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
ATGAGGCAGACATCACAAAGAAGAA[C/T]GCAGAATTGAGAAATTGCTTGGGCT
Phenotype
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
ST18 PubMed Links
Additional Information
For this assay, SNP(s) [rs77490229] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ST18
Gene Name
ST18, C2H2C-type zinc finger
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_014682.2 Intron NP_055497.1
XM_006716487.1 Intron XP_006716550.1
XM_011517629.1 Intron XP_011515931.1
XM_011517631.1 Intron XP_011515933.1
XM_011517632.1 Intron XP_011515934.1
XM_011517633.1 Intron XP_011515935.1
XM_011517634.1 Intron XP_011515936.1
XM_011517635.1 Intron XP_011515937.1
XM_011517636.2 Intron XP_011515938.1
XM_011517637.1 Intron XP_011515939.1
XM_011517638.2 Intron XP_011515940.1
XM_011517641.1 Intron XP_011515943.1
XM_011517642.1 Intron XP_011515944.1
XM_017014047.1 Intron XP_016869536.1
XM_017014048.1 Intron XP_016869537.1
XM_017014049.1 Intron XP_016869538.1
XM_017014050.1 Intron XP_016869539.1
XM_017014051.1 Intron XP_016869540.1
XM_017014052.1 Intron XP_016869541.1
XM_017014053.1 Intron XP_016869542.1
XM_017014054.1 Intron XP_016869543.1
XM_017014055.1 Intron XP_016869544.1
XM_017014056.1 Intron XP_016869545.1
XM_017014057.1 Intron XP_016869546.1
XM_017014058.1 Intron XP_016869547.1
XM_017014059.1 Intron XP_016869548.1
XM_017014060.1 Intron XP_016869549.1
XM_017014061.1 Intron XP_016869550.1
XM_017014062.1 Intron XP_016869551.1
XM_017014063.1 Intron XP_016869552.1
XM_017014064.1 Intron XP_016869553.1
XM_017014065.1 Intron XP_016869554.1
XM_017014066.1 Intron XP_016869555.1
XM_017014067.1 Intron XP_016869556.1
XM_017014068.1 Intron XP_016869557.1
XM_017014069.1 Intron XP_016869558.1
XM_017014070.1 Intron XP_016869559.1
XM_017014071.1 Intron XP_016869560.1
XM_017014072.1 Intron XP_016869561.1
XM_017014073.1 Intron XP_016869562.1
XM_017014074.1 Intron XP_016869563.1
XM_017014075.1 Intron XP_016869564.1
XM_017014076.1 Intron XP_016869565.1
XM_017014077.1 Intron XP_016869566.1
XM_017014078.1 Intron XP_016869567.1
XM_017014079.1 Intron XP_016869568.1
XM_017014080.1 Intron XP_016869569.1
XM_017014081.1 Intron XP_016869570.1
XM_017014082.1 Intron XP_016869571.1
XM_017014083.1 Intron XP_016869572.1
XM_017014084.1 Intron XP_016869573.1

View Full Product Details