Product Details

SNP ID: rs8109430
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:11342647 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AATAAATGGGCATCATTATAGGAGA[A/G]GCTTACAGGATAAAATGGCTGACAC
Phenotype: MIM: 604350 MIM: 613771
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CCDC159 PubMed Links

Gene Details

Gene: CCDC159
Gene Name: coiled-coil domain containing 159

There are no transcripts associated with this gene.

Gene: RAB3D
Gene Name: RAB3D, member RAS oncogene family

There are no transcripts associated with this gene.

Gene: TMEM205
Gene Name: transmembrane protein 205

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145416.1	736	Intron			NP_001138888.1
NM_001321112.1	736	Intron			NP_001308041.1
NM_001321113.1	736	Intron			NP_001308042.1
NM_001321114.1	736	Intron			NP_001308043.1
NM_033408.3	736	Intron			NP_212133.1
NM_198536.2	736	Intron			NP_940938.1
XM_005259899.2	736	Intron			XP_005259956.1
XM_017026769.1	736	Missense Mutation	CTC,TTC	L240F	XP_016882258.1

View Full Product Details