Product Details

SNP ID: rs1127676
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:35545813 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TACTTCATCACCTACAAGTGCAGCG[A/G]CCTGTGAGTGCGGGAAGGGCGCGGG
Phenotype: MIM: 137216 MIM: 609169 MIM: 613585
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATP4A PubMed Links

Gene Details

Gene: ATP4A
Gene Name: ATPase H+/K+ transporting alpha subunit

There are no transcripts associated with this gene.

Gene: GAPDHS
Gene Name: glyceraldehyde-3-phosphate dehydrogenase, spermatogenic

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014364.4	214	Intron			NP_055179.1
XM_017026579.1	214	Intron			XP_016882068.1

Gene: TMEM147
Gene Name: transmembrane protein 147

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242597.1	214	UTR 5			NP_001229526.1
NM_001242598.1	214	Missense Mutation	GAC,GGC	D25G	NP_001229527.1
NM_032635.3	214	Missense Mutation	GAC,GGC	D25G	NP_116024.1

Gene: TMEM147-AS1
Gene Name: TMEM147 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details