Product Details

SNP ID: rs1140049
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:43792992 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCCTTAGGCGGTAACCAGCGTGAG[C/G]TCGCCCGCCAGAAGAATATGAAAAA
Phenotype: MIM: 612784 MIM: 605054 MIM: 614550
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: HYPK PubMed Links

Gene Details

Gene: HYPK
Gene Name: huntingtin interacting protein K

There are no transcripts associated with this gene.

Gene: MIR1282
Gene Name: microRNA 1282

There are no transcripts associated with this gene.

Gene: SERF2
Gene Name: small EDRK-rich factor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001018108.3	426	Missense Mutation	CTC,GTC	L9V	NP_001018118.1
NM_001199875.1	426	Missense Mutation	CTC,GTC	L9V	NP_001186804.1
NM_001199876.1	426	Missense Mutation	CTC,GTC	L9V	NP_001186805.1
NM_001199877.1	426	Missense Mutation	CTC,GTC	L9V	NP_001186806.1
NM_001199878.1	426	UTR 5			NP_001186807.1

Gene: SERF2-C15ORF63
Gene Name: SERF2-C15orf63 readthrough

There are no transcripts associated with this gene.

Gene: SERINC4
Gene Name: serine incorporator 4

There are no transcripts associated with this gene.

View Full Product Details