Product Details

SNP ID
rs28451445
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.16:58471902 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CAGAGTGTGTGAGTGTGTGTGTGTG[A/T]GAGAGAGCAGGGAGTGGAAGAGTCC
Phenotype
MIM: 614463
Polymorphism
A/T, Transversion Substitution
Allele Nomenclature
Literature Links
NDRG4 PubMed Links
Additional Information
For this assay, SNP(s) [rs76726951] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
NDRG4
Gene Name
NDRG family member 4
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001130487.1 Intron NP_001123959.1
NM_001242833.1 Intron NP_001229762.1
NM_001242834.1 Intron NP_001229763.1
NM_001242835.1 Intron NP_001229764.1
NM_001242836.1 Intron NP_001229765.1
NM_020465.3 Intron NP_065198.1
NM_022910.3 Intron NP_075061.1
XM_006721252.3 Intron XP_006721315.1
XM_006721253.3 Intron XP_006721316.1
XM_006721254.3 Intron XP_006721317.1
XM_006721256.3 Intron XP_006721319.1
XM_006721257.3 Intron XP_006721320.1
XM_006721258.3 Intron XP_006721321.1
XM_006721259.3 Intron XP_006721322.1
XM_006721260.3 Intron XP_006721323.1
XM_006721261.3 Intron XP_006721324.1
XM_006721262.3 Intron XP_006721325.1
XM_011523290.2 Intron XP_011521592.1
XM_011523291.2 Intron XP_011521593.1
XM_011523292.2 Intron XP_011521594.1
XM_011523293.2 Intron XP_011521595.1
XM_011523294.2 Intron XP_011521596.1
XM_017023582.1 Intron XP_016879071.1
XM_017023583.1 Intron XP_016879072.1
XM_017023584.1 Intron XP_016879073.1
XM_017023585.1 Intron XP_016879074.1
XM_017023586.1 Intron XP_016879075.1
XM_017023587.1 Intron XP_016879076.1
XM_017023588.1 Intron XP_016879077.1
XM_017023589.1 Intron XP_016879078.1
XM_017023590.1 Intron XP_016879079.1

View Full Product Details