Product Details

SNP ID: rs62454418
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:27147410 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTTTGCCCTGCCCGCTGCTGCTGT[A/C]GGGTTTGTACTGCTGCTCGGGAGAA
Phenotype: MIM: 142954 MIM: 142952 MIM: 142951 MIM: 142950
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: HOXA-AS3 PubMed Links

Gene Details

Gene: HOXA-AS3
Gene Name: HOXA cluster antisense RNA 3

There are no transcripts associated with this gene.

Gene: HOXA3
Gene Name: homeobox A3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_030661.4	365	Intron			NP_109377.1
NM_153631.2	365	Intron			NP_705895.1
XM_005249730.2	365	Intron			XP_005249787.1
XM_005249731.2	365	Intron			XP_005249788.1
XM_005249732.3	365	Intron			XP_005249789.1
XM_006715715.2	365	Intron			XP_006715778.1
XM_011515343.2	365	Intron			XP_011513645.1

Gene: HOXA5
Gene Name: homeobox A5

There are no transcripts associated with this gene.

Gene: HOXA6
Gene Name: homeobox A6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024014.3	365	Missense Mutation			NP_076919.1

Gene: HOXA7
Gene Name: homeobox A7

There are no transcripts associated with this gene.

View Full Product Details